266
Anthology of Human Repetitive DNA
(A)
n
(A)
n
[TSD]
[TSD]
Transcription and splicing
mRNA
Gene
(a)
(b)
(c)
Retrotransposition
Processed pseudogene
pol II
e1
e3
e2
i1
i2
e2
e3
e1
e2
e3
e1
Fig. 5
Formation of processed pseudogenes
(retropseudogenes). (a) The original gene that is transcribed into
RNA, excluding pol II promoter. Exons e1–e3 and introns i1, i2
are indicated. (b) mRNA afer splicing and polyadenylation.
(c) L1-retrotransposed, processed retropseudogene with
15 bp TSDs.
than one million copies in the human
genome, which makes them numerically
the most abundant of all human inter-
spersed repeats. The name ‘‘Alu’’ is de-
rived from an
AluI
restriction site present
in these elements.
Full-length Alu elements are
300-bp
long (Fig. 6) dimers composed of two
homologous 120- and 148-bp left and
right monomers respectively, derived from
the
7SL RNA
gene
100 million years
(Myr) ago. The 7SL RNA molecule is
an important component of the signal
recognition particle (SRP) that binds to
nascent signal sequences and transiently
arrests translation. The
7SL RNA
gene
contains the pol III internal promoter
composed of the conserved
15-bp A and
B boxes. The right monomer contains
an additional 31-bp 7SL-derived sequence
7SL RNA
gene
Ancestral monomeric
Alu
gene (FAM)
Free right monomeric
Alu
gene (FRAM-A)
Free left monomeric
Alu
gene (FLA/FLAM-A)
Ancestral dimeric
Alu
gene
GGCGCGGTGG
Split polymerase III promoter
GTTCGAGAC ACTAAAAATACAAAAATT TTGCAGTGAGCCGAGATCGCGCCACTGCACT
(A)
n
(A)
n
(A)
n
(A)
n
A
B
31 bp
Fig. 6
A scheme for the origin and early
evolution of human Alu master (source) genes.
Dimeric Alu was derived from the
7SL RNA
gene
after a two-step deletion process leading ±rst to
an ancestral family of Alu-like monomers (FAM)
and then to other monomers, of which two,
FLA/FLAM-A, and FRAM, merged into a
precursor of dimeric Alu characteristic
of primates.
previous page 266 Encyclopedia of Molecular Cell Biology and Molecular Medicine read online next page 268 Encyclopedia of Molecular Cell Biology and Molecular Medicine read online Home Toggle text on/off