256
Anthology of Human Repetitive DNA
GTAC
TTTGATATTTTAT
GTAC
AGTATATAATATATATTTTGG
17 bp
25 bp
(b)
Satellite I
(c)
Satellite
a
(a)
SSR
a
1
a
1
a
1
a
2
a
2
a
n
a
n
Fig. 1
Structure of human tandem repeats. (a) Schematic structure of simple
sequence repeats. Arrows represent units ordered in head-to-tail fashion.
(b) Structure of human classical satellite 1. Satellite 1 was originally described as a
17mer (A) and a 25mer (B) arranged in an alternating pattern A-B-A-B. This
structure was inferred from the cutting of human DNA by the
RsaI
restrictase (the
RsaI
cutting sites are highlighted). Further sequence analyses revealed that satellite
1 is in fact composed of a single 42 bp-long basic unit. (c) Diagram of the
hierarchical structure of human alpha satellites, showing the organization of a
typical alpha satellite DNA region. Monomeric 171 bp units are represented by the
small labeled arrows. The hierarchical structure of the alphoid DNA is shown by the
large arrows.
sequence motifs (Fig. 1a). Human tandem
repeats are composed of units ranging in
size from 1 to
1000 bp. On the basis
of unit length and genomic distribution,
they are somewhat arbitrarily divided into
microsatellites, minisatellites, and satel-
lites. Microsatellites are tandem arrays
of short units, while minisatellites are
composed of longer patterns. Micro- and
minisatellites tend to be scattered all over
chromosomal DNA, with some bias toward
telomeric ends. The moderate degree of
tandem repetition and high degree of dis-
persion throughout the chromosomes are
the major features distinguishing micro-
and minisatellites from satellites. Satel-
lites are long, tandemly arrayed sequences
located in well-de±ned chromosomal ar-
eas such as pericentromeric, subtelomeric,
and telomeric regions. Satellites may con-
sist of simple micro- or minisatellite-like
units, but these are often organized into
higher-order structures.
2.1
Microsatellites and Minisatellites
Originally, microsatellites were referred
to as simple sequence repeats (SSRs)
and minisatellites as variable number of
tandem repeats (VNTR). Currently, the
term simple sequence repeats is applied
to both micro- and minisatellites. Micro-
and minisatellite repeats are de±ned by
three parameters: the
pattern
(or sequence
of the unit), unit
length
,andthe
number
of units.
The boundary separating micro- and
minisatellites differs considerably in the
scienti±c literature. Microsatellites are
usually
de±ned
as
repetition
of
1–6
base pair (bp) long units, but the upper
previous page 256 Encyclopedia of Molecular Cell Biology and Molecular Medicine read online next page 258 Encyclopedia of Molecular Cell Biology and Molecular Medicine read online Home Toggle text on/off