574
Chimpanzee Genome
Fragmentation
Size selection,
cloning and
end sequencing
Chimpanzee genomic DNA
DNA sequence
assembly
Human genome sequence
AGCATAGCA
CCGTAGC
CCGTAGC
AAACC
AGCATTTAACTG
AGCATTTAACTG
AGCATAGCA
AAACC
GCCCAAAA
GCCCAAAA
AAACCGTAGCATAGCATTTAACTGCCCAAAA
Fig. 7
Whole-genome shotgun strategy
to sequence the chimpanzee genome.
The entire genome of an individual is
fragmented at random positions and
genomic libraries with a deFned insert
size are generated. Subsequently,
random clones are picked from the
genomic libraries and the DNA
sequences of their insert ends are
determined. In the assembly step, the
individual DNA sequences are aligned
to reconstruct a contiguous consensus
sequence that represents the original
genomic sequence of the chimpanzee.
This step is greatly facilitated for the
chimpanzee genome since the human
genome sequence can serve as a
guideline for the assembly.
most efFcient way to determine an initial
draft sequence of a genome. The general
principle of this strategy is outlined in
┬▒ig. 7. While the generation of the shotgun
sequence reads is considerably straightfor-
ward, their assembly to a comprehensive
consensus sequence comprises the cru-
cial and most problematic step. This step,
however, will be greatly facilitated for the
chimpanzee genome. Given the high sim-
ilarity between both genomes, it will be
in most cases straightforward to align the
chimpanzee DNA sequence fragments to
the human genome sequence. However,
special care must be given to those ge-
nomic regions that differ between the
two species. Human regions not present
in chimpanzees will cause gaps in the
alignment, while chimpanzee DNA se-
quences not present in humans will fail
to align against the human genome. In
addition, recent duplications as well as
inversions of genomic regions comprise
further obstacles on the way toward a
comprehensive draft version of the chim-
panzee genome.
┬▒ollowing
the
shotgun
phase
of
a
genome project, remaining gaps and un-
certainties in the draft sequence must be
removed in the so-called Fnishing phase.
This sequence-Fnishing is tedious, time-
consuming and thus, expensive. However,
it is assumed that the majority of com-
parative studies between chimpanzees and
humans will not substantially beneFt from
a Fnished, rather than a draft version
of the chimpanzee genome. Thus, it is
currently considered to initially leave the
chimpanzee genome sequence in a draft
status. It is estimated that such a draft se-
quence will cover more than 90% of the
chimpanzee genome.
In
conclusion,
a
Frst
draft
of
the
chimpanzee genome sequence can be
generated with considerably low effort and
is likely to be available by the end of 2003.
previous page 1248 Encyclopedia of Molecular Cell Biology and Molecular Medicine read online next page 1250 Encyclopedia of Molecular Cell Biology and Molecular Medicine read online Home Toggle text on/off